ID: 1176488888

View in Genome Browser
Species Human (GRCh38)
Location 21:7430964-7430986
Sequence GGTCCTCGATGCTGGCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176488888_1176488900 15 Left 1176488888 21:7430964-7430986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176488900 21:7431002-7431024 GCCCATCCGGTGCTGTCCCTGGG No data
1176488888_1176488899 14 Left 1176488888 21:7430964-7430986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176488899 21:7431001-7431023 GGCCCATCCGGTGCTGTCCCTGG No data
1176488888_1176488896 2 Left 1176488888 21:7430964-7430986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176488896 21:7430989-7431011 CACATCCGGCCTGGCCCATCCGG No data
1176488888_1176488891 -7 Left 1176488888 21:7430964-7430986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176488891 21:7430980-7431002 GAGGACCCCCACATCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176488888 Original CRISPR GGTCCTCGATGCTGGCCCAG CGG (reversed) Intergenic