ID: 1176493214

View in Genome Browser
Species Human (GRCh38)
Location 21:7477721-7477743
Sequence TCCCGATGTTGGGGGAGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176493214_1176493219 6 Left 1176493214 21:7477721-7477743 CCAACGCTCCCCCAACATCGGGA No data
Right 1176493219 21:7477750-7477772 AAACAAATTTCCTTTTTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176493214 Original CRISPR TCCCGATGTTGGGGGAGCGT TGG (reversed) Intergenic
No off target data available for this crispr