ID: 1176493519

View in Genome Browser
Species Human (GRCh38)
Location 21:7479792-7479814
Sequence TAGTCTAAGGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176493516_1176493519 -3 Left 1176493516 21:7479772-7479794 CCAGCTCAGTGACAGTGCGCTAG No data
Right 1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG No data
1176493515_1176493519 -2 Left 1176493515 21:7479771-7479793 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG No data
1176493514_1176493519 9 Left 1176493514 21:7479760-7479782 CCTAGCATGCACCCAGCTCAGTG No data
Right 1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176493519 Original CRISPR TAGTCTAAGGAGAAAGAGGC AGG Intergenic
No off target data available for this crispr