ID: 1176493845

View in Genome Browser
Species Human (GRCh38)
Location 21:7481825-7481847
Sequence CTCAAAAGCTGTTGAGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176493845_1176493846 -6 Left 1176493845 21:7481825-7481847 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176493846 21:7481842-7481864 TTTGAGAGAAATCTTCCACGTGG No data
1176493845_1176493851 28 Left 1176493845 21:7481825-7481847 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176493851 21:7481876-7481898 ACAGCTTCAGAATTCTGTAGGGG No data
1176493845_1176493850 27 Left 1176493845 21:7481825-7481847 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176493850 21:7481875-7481897 AACAGCTTCAGAATTCTGTAGGG No data
1176493845_1176493849 26 Left 1176493845 21:7481825-7481847 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176493849 21:7481874-7481896 GAACAGCTTCAGAATTCTGTAGG No data
1176493845_1176493852 29 Left 1176493845 21:7481825-7481847 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176493852 21:7481877-7481899 CAGCTTCAGAATTCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176493845 Original CRISPR CTCAAAAGCTGTTGAGCATG AGG (reversed) Intergenic
No off target data available for this crispr