ID: 1176493847

View in Genome Browser
Species Human (GRCh38)
Location 21:7481857-7481879
Sequence CTGTTCATAAGCAGGCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176493847_1176493852 -3 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493852 21:7481877-7481899 CAGCTTCAGAATTCTGTAGGGGG No data
1176493847_1176493850 -5 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493850 21:7481875-7481897 AACAGCTTCAGAATTCTGTAGGG No data
1176493847_1176493853 5 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493853 21:7481885-7481907 GAATTCTGTAGGGGGTGACAAGG No data
1176493847_1176493851 -4 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493851 21:7481876-7481898 ACAGCTTCAGAATTCTGTAGGGG No data
1176493847_1176493854 12 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493854 21:7481892-7481914 GTAGGGGGTGACAAGGTCTGTGG No data
1176493847_1176493855 20 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493855 21:7481900-7481922 TGACAAGGTCTGTGGCTTCCTGG No data
1176493847_1176493849 -6 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493849 21:7481874-7481896 GAACAGCTTCAGAATTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176493847 Original CRISPR CTGTTCATAAGCAGGCCACG TGG (reversed) Intergenic
No off target data available for this crispr