ID: 1176493852

View in Genome Browser
Species Human (GRCh38)
Location 21:7481877-7481899
Sequence CAGCTTCAGAATTCTGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176493845_1176493852 29 Left 1176493845 21:7481825-7481847 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176493852 21:7481877-7481899 CAGCTTCAGAATTCTGTAGGGGG No data
1176493847_1176493852 -3 Left 1176493847 21:7481857-7481879 CCACGTGGCCTGCTTATGAACAG No data
Right 1176493852 21:7481877-7481899 CAGCTTCAGAATTCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176493852 Original CRISPR CAGCTTCAGAATTCTGTAGG GGG Intergenic
No off target data available for this crispr