ID: 1176500556

View in Genome Browser
Species Human (GRCh38)
Location 21:7596964-7596986
Sequence TATTTCCTTCATTTCAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176500556_1176500560 22 Left 1176500556 21:7596964-7596986 CCAAGGTTGAAATGAAGGAAATA No data
Right 1176500560 21:7597009-7597031 GAAGTCAGGTTACCTACAAATGG No data
1176500556_1176500561 25 Left 1176500556 21:7596964-7596986 CCAAGGTTGAAATGAAGGAAATA No data
Right 1176500561 21:7597012-7597034 GTCAGGTTACCTACAAATGGAGG No data
1176500556_1176500559 8 Left 1176500556 21:7596964-7596986 CCAAGGTTGAAATGAAGGAAATA No data
Right 1176500559 21:7596995-7597017 GGCAGACAGAGAGAGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176500556 Original CRISPR TATTTCCTTCATTTCAACCT TGG (reversed) Intergenic
No off target data available for this crispr