ID: 1176500561

View in Genome Browser
Species Human (GRCh38)
Location 21:7597012-7597034
Sequence GTCAGGTTACCTACAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176500556_1176500561 25 Left 1176500556 21:7596964-7596986 CCAAGGTTGAAATGAAGGAAATA No data
Right 1176500561 21:7597012-7597034 GTCAGGTTACCTACAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176500561 Original CRISPR GTCAGGTTACCTACAAATGG AGG Intergenic
No off target data available for this crispr