ID: 1176503516

View in Genome Browser
Species Human (GRCh38)
Location 21:7626264-7626286
Sequence TCGATTGTCCCCGTGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176503511_1176503516 11 Left 1176503511 21:7626230-7626252 CCGGCATTCTCTGTTATTACTCG No data
Right 1176503516 21:7626264-7626286 TCGATTGTCCCCGTGTTTGAGGG No data
1176503510_1176503516 15 Left 1176503510 21:7626226-7626248 CCTTCCGGCATTCTCTGTTATTA No data
Right 1176503516 21:7626264-7626286 TCGATTGTCCCCGTGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176503516 Original CRISPR TCGATTGTCCCCGTGTTTGA GGG Intergenic
No off target data available for this crispr