ID: 1176504412

View in Genome Browser
Species Human (GRCh38)
Location 21:7635182-7635204
Sequence TCTCTGAGTAGACCAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176504412_1176504416 12 Left 1176504412 21:7635182-7635204 CCTGCTATTGGTCTACTCAGAGA No data
Right 1176504416 21:7635217-7635239 CTCGTTTAGTCTTGGAGGTGTGG No data
1176504412_1176504417 23 Left 1176504412 21:7635182-7635204 CCTGCTATTGGTCTACTCAGAGA No data
Right 1176504417 21:7635228-7635250 TTGGAGGTGTGGATGTTTCCAGG No data
1176504412_1176504413 4 Left 1176504412 21:7635182-7635204 CCTGCTATTGGTCTACTCAGAGA No data
Right 1176504413 21:7635209-7635231 ACTTCTTCCTCGTTTAGTCTTGG 0: 63
1: 8146
2: 3955
3: 2093
4: 2188
1176504412_1176504414 7 Left 1176504412 21:7635182-7635204 CCTGCTATTGGTCTACTCAGAGA No data
Right 1176504414 21:7635212-7635234 TCTTCCTCGTTTAGTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176504412 Original CRISPR TCTCTGAGTAGACCAATAGC AGG (reversed) Intergenic
No off target data available for this crispr