ID: 1176504573

View in Genome Browser
Species Human (GRCh38)
Location 21:7637326-7637348
Sequence TTGCAGCCCTACCACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176504571_1176504573 13 Left 1176504571 21:7637290-7637312 CCATTTTACCAAAGGCTAACGCT No data
Right 1176504573 21:7637326-7637348 TTGCAGCCCTACCACTGAAAAGG No data
1176504572_1176504573 5 Left 1176504572 21:7637298-7637320 CCAAAGGCTAACGCTAAAATACT No data
Right 1176504573 21:7637326-7637348 TTGCAGCCCTACCACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176504573 Original CRISPR TTGCAGCCCTACCACTGAAA AGG Intergenic
No off target data available for this crispr