ID: 1176506790

View in Genome Browser
Species Human (GRCh38)
Location 21:7656506-7656528
Sequence CAGCTTCAGAATTCTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176506790_1176506797 29 Left 1176506790 21:7656506-7656528 CCCCCTACAGAATTCTGAAGCTG No data
Right 1176506797 21:7656558-7656580 CTCAAAAGCTGTTGAGCATGAGG No data
1176506790_1176506795 -3 Left 1176506790 21:7656506-7656528 CCCCCTACAGAATTCTGAAGCTG No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176506790 Original CRISPR CAGCTTCAGAATTCTGTAGG GGG (reversed) Intergenic
No off target data available for this crispr