ID: 1176506795

View in Genome Browser
Species Human (GRCh38)
Location 21:7656526-7656548
Sequence CTGTTCATAAGCAGGCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176506791_1176506795 -4 Left 1176506791 21:7656507-7656529 CCCCTACAGAATTCTGAAGCTGT No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data
1176506789_1176506795 5 Left 1176506789 21:7656498-7656520 CCTTGTCACCCCCTACAGAATTC No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data
1176506788_1176506795 12 Left 1176506788 21:7656491-7656513 CCACAGACCTTGTCACCCCCTAC No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data
1176506793_1176506795 -6 Left 1176506793 21:7656509-7656531 CCTACAGAATTCTGAAGCTGTTC No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data
1176506790_1176506795 -3 Left 1176506790 21:7656506-7656528 CCCCCTACAGAATTCTGAAGCTG No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data
1176506787_1176506795 20 Left 1176506787 21:7656483-7656505 CCAGGAAGCCACAGACCTTGTCA No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data
1176506792_1176506795 -5 Left 1176506792 21:7656508-7656530 CCCTACAGAATTCTGAAGCTGTT No data
Right 1176506795 21:7656526-7656548 CTGTTCATAAGCAGGCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176506795 Original CRISPR CTGTTCATAAGCAGGCCACG TGG Intergenic
No off target data available for this crispr