ID: 1176506797

View in Genome Browser
Species Human (GRCh38)
Location 21:7656558-7656580
Sequence CTCAAAAGCTGTTGAGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176506791_1176506797 28 Left 1176506791 21:7656507-7656529 CCCCTACAGAATTCTGAAGCTGT No data
Right 1176506797 21:7656558-7656580 CTCAAAAGCTGTTGAGCATGAGG No data
1176506793_1176506797 26 Left 1176506793 21:7656509-7656531 CCTACAGAATTCTGAAGCTGTTC No data
Right 1176506797 21:7656558-7656580 CTCAAAAGCTGTTGAGCATGAGG No data
1176506790_1176506797 29 Left 1176506790 21:7656506-7656528 CCCCCTACAGAATTCTGAAGCTG No data
Right 1176506797 21:7656558-7656580 CTCAAAAGCTGTTGAGCATGAGG No data
1176506792_1176506797 27 Left 1176506792 21:7656508-7656530 CCCTACAGAATTCTGAAGCTGTT No data
Right 1176506797 21:7656558-7656580 CTCAAAAGCTGTTGAGCATGAGG No data
1176506796_1176506797 -6 Left 1176506796 21:7656541-7656563 CCACGTGGAAGATTTCTCTCAAA No data
Right 1176506797 21:7656558-7656580 CTCAAAAGCTGTTGAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176506797 Original CRISPR CTCAAAAGCTGTTGAGCATG AGG Intergenic
No off target data available for this crispr