ID: 1176507123

View in Genome Browser
Species Human (GRCh38)
Location 21:7658591-7658613
Sequence TAGTCTAAGGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176507123_1176507128 9 Left 1176507123 21:7658591-7658613 CCTGCCTCTTTCTCCTTAGACTA No data
Right 1176507128 21:7658623-7658645 CACTGAGCTGGGTGCATGCTAGG No data
1176507123_1176507126 -3 Left 1176507123 21:7658591-7658613 CCTGCCTCTTTCTCCTTAGACTA No data
Right 1176507126 21:7658611-7658633 CTAGCGCACTGTCACTGAGCTGG No data
1176507123_1176507127 -2 Left 1176507123 21:7658591-7658613 CCTGCCTCTTTCTCCTTAGACTA No data
Right 1176507127 21:7658612-7658634 TAGCGCACTGTCACTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176507123 Original CRISPR TAGTCTAAGGAGAAAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr