ID: 1176507428

View in Genome Browser
Species Human (GRCh38)
Location 21:7660662-7660684
Sequence TCCCGATGTTGGGGGAGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176507423_1176507428 6 Left 1176507423 21:7660633-7660655 CCGTAAAAAAAGGAAATTTGTTT No data
Right 1176507428 21:7660662-7660684 TCCCGATGTTGGGGGAGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176507428 Original CRISPR TCCCGATGTTGGGGGAGCGT TGG Intergenic
No off target data available for this crispr