ID: 1176508366

View in Genome Browser
Species Human (GRCh38)
Location 21:7672592-7672614
Sequence TGTTCACTCAGGACATCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 5, 1: 5, 2: 0, 3: 8, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176508366 Original CRISPR TGTTCACTCAGGACATCGTC AGG Intergenic
906979832 1:50618350-50618372 TGTTCACTCAGGAGTTATTCTGG + Intronic
908597672 1:65706027-65706049 TGTTCCCTTAGGACATTGTGAGG + Intergenic
911908286 1:103597089-103597111 TTTTAACACAGGACATCTTCTGG + Intergenic
911914632 1:103682377-103682399 TTTTAACACAGGACATCTTCTGG - Intronic
916641478 1:166732912-166732934 TGTTCACCCAGGAGTTAGTCAGG - Intergenic
1063621106 10:7650143-7650165 GGGTGACTCAGGACATCCTCGGG - Intronic
1067245954 10:44543959-44543981 TGTTCACTCAGGACTTATTCAGG + Intergenic
1073001176 10:100287123-100287145 TGTTAACTCAGGACATTGGGAGG - Intergenic
1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG + Exonic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1078450855 11:11439696-11439718 TGTTCACTCAGCCCATCACCAGG - Intronic
1083808650 11:65089858-65089880 TGCTCACTCAGCACAGCCTCAGG - Intronic
1104930858 12:132338784-132338806 TGTTCACTCAGGACGCCGCATGG - Intergenic
1118662133 14:68026097-68026119 TGTTCACCCAGGACTTATTCAGG + Intronic
1120333398 14:83122826-83122848 TATTCAGTCAGGCCATAGTCAGG + Intergenic
1121660200 14:95629372-95629394 TTTTCAATCAGGACATTGGCAGG - Intergenic
1124245469 15:28067586-28067608 TGTTCACTCAGGACTTATTCAGG + Intronic
1126206548 15:46051993-46052015 TGTTCACTCAGGAGCTATTCAGG + Intergenic
1130330682 15:82920000-82920022 TGTTCACTCTGTCCATTGTCTGG + Intronic
1130642928 15:85696334-85696356 TCTTCACTCAGGAGATGGGCTGG - Intronic
1136648978 16:31649115-31649137 TGCACACTCAGGACAACGTGTGG - Intergenic
1139033929 16:62919835-62919857 TGTTGACATAGGACATAGTCTGG + Intergenic
1139766883 16:69238080-69238102 TGTCCACGCAGGTCAGCGTCCGG - Intronic
1141961391 16:87411710-87411732 TGCCCACTCAGGACAGGGTCTGG + Exonic
1203166478 17_GL000205v2_random:101762-101784 TGTTCACTCAGGACATCATCAGG + Intergenic
1153815416 18:8786171-8786193 TGTTCCCTCAGGGCCTCGTCCGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1168238792 19:55079074-55079096 TGTTCCCCCAGGACATCTTCTGG + Intronic
935071759 2:99700641-99700663 TGTTCCCTCAGGACACTTTCAGG - Intronic
936057364 2:109271029-109271051 TGTATACTCAGGACATCACCAGG - Intronic
942224819 2:173805778-173805800 TGTTAAGTCAGGACATTGTCAGG + Intergenic
1172244115 20:33433965-33433987 TGTTCTCCCAGGACATCCTCAGG + Intronic
1173426580 20:42948425-42948447 TGTTCACTCAGGCCAGGGGCAGG - Intronic
1174200659 20:48804426-48804448 TGTGCACTCATGACCTCTTCAGG - Intronic
1175275066 20:57762788-57762810 TGTTCACTGACGCCATCCTCAGG - Intergenic
1176335053 21:5588787-5588809 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176392704 21:6232161-6232183 TGTTCACTCAGGACATCGTCAGG + Intergenic
1176405277 21:6357334-6357356 TGTTCACTCAGGACATCATCAGG - Intergenic
1176431880 21:6631769-6631791 TGTTCACTCAGGACATCATCAGG + Intergenic
1176468715 21:7084013-7084035 TGTTCACTCAGGACATCGTCAGG - Intronic
1176492276 21:7465791-7465813 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176508366 21:7672592-7672614 TGTTCACTCAGGACATCGTCAGG + Intergenic
1177954361 21:27578832-27578854 TGTTCATTAATGACATTGTCTGG - Intergenic
1179274602 21:39880673-39880695 TGTTCCCTCCGGACATACTCAGG - Intronic
1183186836 22:36296670-36296692 TGTGCACTCAGGGCATGGTGAGG - Intronic
1183419302 22:37701378-37701400 TGTTCACACAGGGCATCCCCAGG - Exonic
1184899946 22:47439828-47439850 TGTTCAGTGATGACATCATCCGG + Intergenic
949282139 3:2358856-2358878 TCTTCATTCATGACATCCTCTGG - Intronic
951027479 3:17845161-17845183 TGTTCAGTCACGACATTGTAGGG - Intronic
970294173 4:14610646-14610668 TGTCCTCCCAGGACATCATCTGG + Intergenic
970948988 4:21730421-21730443 TGCACACTCAGGACATGCTCAGG + Intronic
979867311 4:125772600-125772622 TGTTCACTGAAGACATTTTCTGG + Intergenic
990020117 5:51116403-51116425 TGTCCACTCAGGAGACCTTCAGG + Intergenic
992047304 5:72906909-72906931 TGCTCATTCAGCACATCTTCTGG - Intronic
999119614 5:149199033-149199055 TCTTCTCTCAGGACATCTCCAGG + Intronic
1000981040 5:167817180-167817202 TGTTCACTCAGTCCAGCATCAGG + Intronic
1001141620 5:169148930-169148952 TGTACACTGAGCACAGCGTCTGG - Intronic
1006633734 6:35447476-35447498 TCTTCACCCAGGAGATAGTCAGG + Intergenic
1010590108 6:77702223-77702245 TGTTTCCTCAGTACGTCGTCTGG - Intronic
1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG + Exonic
1017358050 6:153533554-153533576 TGTTCACTCAGGAATTATTCAGG + Intergenic
1017859134 6:158379027-158379049 TGTTCACTCTGGACCTCCTAAGG - Intronic
1019118937 6:169787929-169787951 TGTTCACTCAGGAAAAGGTCGGG - Intergenic
1023870515 7:44260879-44260901 TGCTGACCCAGGACATGGTCTGG - Intronic
1026661612 7:72307830-72307852 TGTTGCCTCAGGACATCTGCTGG + Intronic
1028180505 7:87716337-87716359 AGCTCACTCAGGAAATCTTCAGG - Intronic
1029475954 7:100784754-100784776 TCTTCACTCAGCACATAGCCGGG - Exonic
1037940846 8:22949646-22949668 TGTTCACCCACGTGATCGTCTGG - Intronic
1039891026 8:41685521-41685543 TGTCCTCTCAGGACACAGTCTGG - Intronic
1041687635 8:60658817-60658839 TGTTCATTGAGGACATCACCTGG + Intergenic
1042099515 8:65259626-65259648 TGTGCACTCAAGATATCCTCTGG - Intergenic
1046454766 8:114443496-114443518 TGTTCACCCAGGAGTTCTTCAGG - Intergenic
1048026470 8:130591890-130591912 TGTTCACTGAGGACCTGGTCAGG + Intergenic
1049038777 8:140097255-140097277 TGTGCACTCAGGACCTGGTGGGG - Intronic
1051376875 9:16410904-16410926 TATTAACTCAGCACATTGTCTGG + Exonic
1056795588 9:89656609-89656631 TGATCACTGTGGACATGGTCAGG - Intergenic
1060062639 9:120474841-120474863 TGTTCACTCTGGAAATTGACAGG - Intronic
1203426588 Un_GL000195v1:46129-46151 TGTTCTCTCAGGACATCGTCAGG + Intergenic
1203439659 Un_GL000195v1:176939-176961 TGTTCACTCAGGACATCATCAGG - Intergenic
1191175701 X:57499090-57499112 TGTTCACTCAGGAGTTATTCTGG - Intergenic
1194770396 X:97896808-97896830 TGTTCACTCAGGATATAACCTGG + Intergenic
1194959671 X:100220838-100220860 TGTCCACTCAGGACAGCTTTGGG - Intergenic
1195567532 X:106359968-106359990 TGTTCATTAAGGACATTGGCAGG + Intergenic
1198434323 X:136600851-136600873 TGTCCACTCATGTCATTGTCAGG + Intergenic
1199099074 X:143777538-143777560 TGTTCACTCAGGAGTTATTCAGG + Intergenic
1199449295 X:147961664-147961686 TGTTCACTCAGGCCCTGTTCAGG - Intergenic