ID: 1176513304

View in Genome Browser
Species Human (GRCh38)
Location 21:7764662-7764684
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 592}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176513304 Original CRISPR CCATCTGCAATATCTGCAAT CGG (reversed) Intronic
901357938 1:8668089-8668111 CCCTTTGAAATCTCTGCAATAGG - Intronic
903197300 1:21700525-21700547 CCATCTGCAATATCTGTGACAGG - Intronic
905244026 1:36600082-36600104 CCATCTCCAAATTCAGCAATGGG - Intergenic
905889722 1:41511437-41511459 CCAGCTGCCATCTCTGGAATGGG + Intronic
905987202 1:42296962-42296984 TCATCTGCAATTTCTTCCATTGG + Intronic
906443009 1:45867009-45867031 ACATCTGCAATCCCAGCAATTGG - Intronic
908520137 1:64933559-64933581 CCCTCAGCAATCTCTGCCATGGG + Intronic
909096606 1:71295810-71295832 TGATTTGCAATATCTGCCATGGG + Intergenic
913722795 1:121616835-121616857 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913722935 1:121618701-121618723 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913722977 1:121619505-121619527 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723124 1:121621370-121621392 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723138 1:121621638-121621660 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723296 1:121623507-121623529 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723446 1:121625373-121625395 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723459 1:121625641-121625663 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723769 1:121629373-121629395 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723814 1:121630047-121630069 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723972 1:121631916-121631938 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724136 1:121633782-121633804 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724466 1:121637520-121637542 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724797 1:121641258-121641280 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724959 1:121643127-121643149 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725124 1:121644995-121645017 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725285 1:121646861-121646883 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725446 1:121648727-121648749 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725615 1:121650592-121650614 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725783 1:121652458-121652480 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725943 1:121654323-121654345 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726111 1:121656188-121656210 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726278 1:121658054-121658076 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726440 1:121659920-121659942 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726605 1:121661786-121661808 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726767 1:121663651-121663673 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913727099 1:121667381-121667403 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913727935 1:121676710-121676732 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913728761 1:121686040-121686062 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913728914 1:121687904-121687926 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729511 1:121695363-121695385 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729664 1:121697229-121697251 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729821 1:121699095-121699117 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729977 1:121700961-121700983 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730135 1:121702827-121702849 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730289 1:121704693-121704715 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730445 1:121706559-121706581 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730599 1:121708425-121708447 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730751 1:121710291-121710313 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730902 1:121712157-121712179 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731060 1:121714023-121714045 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731211 1:121715889-121715911 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731362 1:121717755-121717777 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731511 1:121719620-121719642 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731666 1:121721486-121721508 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731816 1:121723351-121723373 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731974 1:121725217-121725239 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732126 1:121727083-121727105 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732276 1:121728948-121728970 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732433 1:121730813-121730835 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732581 1:121732678-121732700 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732955 1:121736711-121736733 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913733102 1:121738575-121738597 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913733302 1:121741287-121741309 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913735409 1:121777865-121777887 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913735785 1:121782272-121782294 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913735959 1:121784133-121784155 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736125 1:121785998-121786020 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736282 1:121787863-121787885 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736434 1:121789731-121789753 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736585 1:121791600-121791622 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736767 1:121793788-121793810 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736941 1:121795654-121795676 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737218 1:121798794-121798816 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737468 1:121801630-121801652 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737630 1:121803494-121803516 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737780 1:121805184-121805206 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737944 1:121807046-121807068 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913738161 1:121809575-121809597 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913738321 1:121811405-121811427 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913738517 1:121813800-121813822 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913738823 1:121817220-121817242 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913738984 1:121819086-121819108 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913739152 1:121820952-121820974 CCTTCTGCAAAATCTGCTAGTGG + Intergenic
913739321 1:121822816-121822838 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913739457 1:121824671-121824693 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739471 1:121824939-121824961 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739626 1:121826921-121826943 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739640 1:121827189-121827211 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739655 1:121827457-121827479 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739669 1:121827725-121827747 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739855 1:121829961-121829983 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739869 1:121830229-121830251 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739897 1:121830765-121830787 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740046 1:121832630-121832652 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740060 1:121832898-121832920 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740213 1:121834759-121834781 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740368 1:121836628-121836650 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740381 1:121836896-121836918 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740685 1:121840628-121840650 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740732 1:121841302-121841324 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740891 1:121843170-121843192 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741050 1:121845035-121845057 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741222 1:121847078-121847100 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741385 1:121848947-121848969 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741552 1:121850815-121850837 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742555 1:121864091-121864113 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742696 1:121865957-121865979 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742710 1:121866225-121866247 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742838 1:121867825-121867847 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742852 1:121868093-121868115 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742867 1:121868361-121868383 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742881 1:121868629-121868651 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913743413 1:121874442-121874464 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913743897 1:121880030-121880052 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744065 1:121881899-121881921 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744222 1:121883766-121883788 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744387 1:121885632-121885654 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744523 1:121887497-121887519 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744685 1:121889363-121889385 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744839 1:121891179-121891201 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745003 1:121893044-121893066 CCTTCTGCAAAATCTGCTAGTGG - Intergenic
913745050 1:121893791-121893813 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745205 1:121895657-121895679 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745362 1:121897523-121897545 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745580 1:121900216-121900238 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745735 1:121902082-121902104 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745770 1:121902693-121902715 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745926 1:121904559-121904581 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746085 1:121906425-121906447 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746233 1:121908289-121908311 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746565 1:121912367-121912389 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746882 1:121915870-121915892 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747050 1:121917917-121917939 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747215 1:121919783-121919805 CCTTCTGCAGAATCTGCAACTGG - Intergenic
913747380 1:121921649-121921671 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747678 1:121925014-121925036 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747848 1:121926934-121926956 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913748483 1:121934332-121934354 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913748873 1:121939134-121939156 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913749131 1:121942057-121942079 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913749343 1:121944561-121944583 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913749494 1:121946430-121946452 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913749924 1:121951956-121951978 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750057 1:121953718-121953740 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750215 1:121955584-121955606 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750290 1:121956666-121956688 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750304 1:121956934-121956956 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750319 1:121957202-121957224 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750333 1:121957470-121957492 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750419 1:121958678-121958700 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750574 1:121960544-121960566 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750730 1:121962410-121962432 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750857 1:121964078-121964100 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913751556 1:121973313-121973335 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913751826 1:122026543-122026565 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913751984 1:122028407-122028429 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752143 1:122030274-122030296 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752295 1:122032139-122032161 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752456 1:122034007-122034029 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752617 1:122035873-122035895 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752786 1:122037740-122037762 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752949 1:122039609-122039631 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753109 1:122041475-122041497 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753277 1:122043340-122043362 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753439 1:122045206-122045228 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753600 1:122047073-122047095 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753619 1:122047413-122047435 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753777 1:122049279-122049301 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753938 1:122051144-122051166 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754097 1:122053014-122053036 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754263 1:122054880-122054902 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754421 1:122056748-122056770 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754572 1:122058696-122058718 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754731 1:122060562-122060584 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754887 1:122062428-122062450 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755042 1:122064294-122064316 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755374 1:122068029-122068051 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755542 1:122069894-122069916 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755706 1:122071759-122071781 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755860 1:122073624-122073646 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756013 1:122075492-122075514 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756179 1:122077357-122077379 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756337 1:122079222-122079244 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756498 1:122081088-122081110 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756654 1:122082954-122082976 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756814 1:122084823-122084845 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756823 1:122084993-122085015 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913757152 1:122088725-122088747 CCTTCTGCAGAATCTGCAACTGG + Intergenic
913757634 1:122094323-122094345 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913757801 1:122096192-122096214 CCTTCTGCAAAATCTGCTAGTGG + Intergenic
913757960 1:122098058-122098080 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758118 1:122099923-122099945 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758290 1:122101793-122101815 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758483 1:122104198-122104220 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758809 1:122107933-122107955 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758999 1:122110053-122110075 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759168 1:122111921-122111943 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759320 1:122113789-122113811 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759475 1:122115654-122115676 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759624 1:122117522-122117544 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759781 1:122119389-122119411 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760104 1:122123122-122123144 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760270 1:122124990-122125012 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760487 1:122127191-122127213 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760809 1:122130925-122130947 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760968 1:122132789-122132811 CCTTCTGCAAAATCTGCTAGTGG + Intergenic
913761126 1:122134654-122134676 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761296 1:122136521-122136543 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761455 1:122138387-122138409 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761618 1:122140253-122140275 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761779 1:122142123-122142145 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761935 1:122143989-122144011 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762097 1:122145853-122145875 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762263 1:122147719-122147741 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762431 1:122149585-122149607 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762592 1:122151450-122151472 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762757 1:122153316-122153338 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762904 1:122155182-122155204 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763230 1:122158913-122158935 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763556 1:122162645-122162667 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763718 1:122164511-122164533 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763874 1:122166376-122166398 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764036 1:122168242-122168264 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764201 1:122170112-122170134 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764515 1:122173845-122173867 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764701 1:122175917-122175939 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765007 1:122179650-122179672 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765339 1:122183382-122183404 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765445 1:122184736-122184758 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765604 1:122186605-122186627 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765763 1:122188470-122188492 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765930 1:122190506-122190528 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766089 1:122192372-122192394 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766255 1:122194239-122194261 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766425 1:122196105-122196127 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766584 1:122197970-122197992 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766740 1:122199836-122199858 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766903 1:122201702-122201724 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767066 1:122203571-122203593 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767224 1:122205440-122205462 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767389 1:122207310-122207332 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767542 1:122209176-122209198 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767701 1:122211042-122211064 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767868 1:122212908-122212930 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768021 1:122214774-122214796 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768357 1:122218511-122218533 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768516 1:122220377-122220399 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768838 1:122224113-122224135 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768947 1:122225571-122225593 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769092 1:122227438-122227460 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769228 1:122229305-122229327 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769550 1:122233547-122233569 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769681 1:122235414-122235436 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769814 1:122237280-122237302 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769958 1:122239230-122239252 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770097 1:122241095-122241117 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770235 1:122242962-122242984 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770378 1:122244828-122244850 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770518 1:122246694-122246716 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770657 1:122248560-122248582 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770798 1:122250426-122250448 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770941 1:122252293-122252315 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771080 1:122254160-122254182 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771220 1:122256026-122256048 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771360 1:122257892-122257914 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771500 1:122259757-122259779 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771640 1:122261623-122261645 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771821 1:122264163-122264185 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771960 1:122266029-122266051 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772098 1:122267895-122267917 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772235 1:122269760-122269782 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772371 1:122271625-122271647 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772513 1:122273492-122273514 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772654 1:122275358-122275380 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772794 1:122277224-122277246 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772932 1:122279090-122279112 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773072 1:122280957-122280979 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773208 1:122282823-122282845 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773348 1:122284688-122284710 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773491 1:122286554-122286576 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773630 1:122288420-122288442 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773770 1:122290286-122290308 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773908 1:122292152-122292174 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774051 1:122294018-122294040 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774188 1:122295884-122295906 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774326 1:122297750-122297772 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774465 1:122299616-122299638 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774607 1:122301482-122301504 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774746 1:122303348-122303370 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774885 1:122305214-122305236 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775024 1:122307080-122307102 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775161 1:122308946-122308968 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775299 1:122310812-122310834 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775578 1:122314544-122314566 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775716 1:122316410-122316432 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775854 1:122318277-122318299 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775994 1:122320144-122320166 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776137 1:122322010-122322032 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776421 1:122325745-122325767 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776561 1:122327610-122327632 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776704 1:122329476-122329498 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776844 1:122331341-122331363 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776985 1:122333208-122333230 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777123 1:122335074-122335096 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777263 1:122336939-122336961 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777403 1:122338805-122338827 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777538 1:122340657-122340679 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777680 1:122342523-122342545 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777817 1:122344392-122344414 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777957 1:122346258-122346280 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778101 1:122348124-122348146 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778242 1:122349986-122350008 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778380 1:122351851-122351873 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778523 1:122353717-122353739 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778663 1:122355583-122355605 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778798 1:122357448-122357470 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778937 1:122359314-122359336 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779076 1:122361179-122361201 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779221 1:122363047-122363069 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779363 1:122364913-122364935 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779499 1:122366780-122366802 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779632 1:122368645-122368667 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779776 1:122370511-122370533 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779918 1:122372378-122372400 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780057 1:122374244-122374266 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780193 1:122376109-122376131 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780335 1:122377975-122377997 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780613 1:122381706-122381728 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780752 1:122383574-122383596 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780894 1:122385439-122385461 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781187 1:122389177-122389199 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781322 1:122391043-122391065 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781460 1:122392909-122392931 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781597 1:122394775-122394797 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781737 1:122396641-122396663 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781877 1:122398507-122398529 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782018 1:122400373-122400395 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782156 1:122402237-122402259 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782297 1:122404104-122404126 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782441 1:122405971-122405993 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782584 1:122407838-122407860 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782722 1:122409704-122409726 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783006 1:122413437-122413459 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783146 1:122415303-122415325 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783274 1:122417001-122417023 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783284 1:122417171-122417193 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783423 1:122419037-122419059 CCTTCTGCAGAATCTGCAAGAGG + Intergenic
913783558 1:122420903-122420925 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783699 1:122422770-122422792 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783837 1:122424635-122424657 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783973 1:122426501-122426523 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784238 1:122429896-122429918 CCTTCTGCACAATCTGCAATTGG + Intergenic
913784373 1:122431760-122431782 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784514 1:122433627-122433649 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784652 1:122435493-122435515 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784789 1:122437358-122437380 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784926 1:122439224-122439246 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785207 1:122442956-122442978 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785348 1:122444822-122444844 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785486 1:122446688-122446710 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785630 1:122448556-122448578 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785771 1:122450422-122450444 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785925 1:122452459-122452481 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786204 1:122456191-122456213 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786339 1:122458056-122458078 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786484 1:122459922-122459944 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786626 1:122461788-122461810 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786775 1:122463851-122463873 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786913 1:122465717-122465739 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787050 1:122467584-122467606 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787184 1:122469449-122469471 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787325 1:122471314-122471336 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787462 1:122473179-122473201 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787602 1:122475044-122475066 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787740 1:122476910-122476932 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787878 1:122478777-122478799 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788015 1:122480644-122480666 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788157 1:122482508-122482530 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788300 1:122484373-122484395 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788439 1:122486239-122486261 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788577 1:122488106-122488128 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788715 1:122489971-122489993 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788855 1:122491837-122491859 CCTTCTGCAGAATCTGCAAGAGG + Intergenic
913788994 1:122493703-122493725 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789133 1:122495569-122495591 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789266 1:122497462-122497484 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789409 1:122499328-122499350 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789552 1:122501195-122501217 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789692 1:122503061-122503083 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
916169049 1:161986931-161986953 CCATCTGCAATTTCTGTGTTTGG - Intronic
917653436 1:177102041-177102063 CAGTCTGCAGTATCTGAAATGGG + Intronic
918476109 1:184927358-184927380 ACTTCTGCCATATCTGCATTAGG + Intronic
918966600 1:191358166-191358188 CCATCAGCAATATATGTAAAGGG - Intergenic
920068608 1:203286898-203286920 CCAGCTGCAATCTCTACAAGTGG - Intergenic
922121964 1:222680091-222680113 CCATCTGCAGCCCCTGCAATGGG + Intronic
923644886 1:235809202-235809224 CCATCTGCAGTCTCTTCAAATGG + Exonic
1064578395 10:16768987-16769009 CCATCGGTAATACCTGCAACAGG + Intronic
1066258871 10:33709346-33709368 CCATCTGAACTAGCTGCAAATGG + Intergenic
1069210620 10:65754914-65754936 CCATATGAAATATCTGGAATAGG - Intergenic
1070601241 10:77867807-77867829 CCATCAGCAATAACTGCTGTGGG - Intronic
1074006673 10:109432695-109432717 CTATCAGCAATATCATCAATGGG + Intergenic
1075787593 10:125060717-125060739 CCATCTGCAATCTCTCCTCTTGG - Intronic
1076498278 10:130913847-130913869 GCATCTGCACTGTCTGCAATTGG - Intergenic
1079683840 11:23331852-23331874 GCATTGGCAATAGCTGCAATGGG + Intergenic
1080551711 11:33378273-33378295 CCATCTGTAATATGTGAAACTGG + Intergenic
1082315720 11:50717770-50717792 CCTTTTGTAATATCTGCAAACGG - Intergenic
1092214180 12:6669043-6669065 ACACCTGCACTATCTGCAGTCGG - Exonic
1094455632 12:30629688-30629710 CCATATGCAATATTTCCTATAGG + Exonic
1097332974 12:58352561-58352583 CTTTCTTCAATACCTGCAATTGG - Intergenic
1100301630 12:93313271-93313293 CCTTCTGAAATCTCTGCAGTGGG - Intergenic
1100532738 12:95474982-95475004 CTATCTGCACTGCCTGCAATTGG - Intronic
1100921724 12:99495911-99495933 CCTTCTGCAACATCTGAAATAGG - Intronic
1103053236 12:117799012-117799034 TTATCTGAAATATCTGGAATAGG + Intronic
1104021985 12:124998536-124998558 GCATATGAAATATCTGGAATAGG + Intronic
1104702294 12:130916213-130916235 CCAGCTGAAATATGTGCTATGGG + Intergenic
1105077900 13:16060350-16060372 CTATTTGTAGTATCTGCAATTGG + Intergenic
1107266943 13:38567183-38567205 GCATCTGAAGTACCTGCAATGGG + Intergenic
1108892890 13:55283532-55283554 GCATCTGGAATCTCAGCAATAGG - Intergenic
1110034215 13:70658698-70658720 CCATGAGCAATATCTGAAAATGG + Intergenic
1110409848 13:75192620-75192642 TCATCTGCATTTTCTGTAATGGG - Intergenic
1111718304 13:91909668-91909690 CCATCTTTATTATCTGTAATAGG - Intronic
1111890281 13:94073000-94073022 CTATCTGCAATTTCTTGAATGGG - Intronic
1114325571 14:21585641-21585663 TCATCTGCAACATCTGAGATGGG + Intergenic
1115118577 14:29912013-29912035 CCATCTGCAAAGTCAGCAAAAGG + Intronic
1117872066 14:60211455-60211477 AATTCTACAATATCTGCAATAGG - Intergenic
1119441664 14:74632424-74632446 CCAGTTGCAATATTTGCAATGGG + Intergenic
1120635634 14:86947160-86947182 TCATCTGAAATATCCGTAATAGG - Intergenic
1121765323 14:96480907-96480929 GCCTCTGCAATGTCTGGAATGGG + Intronic
1127743536 15:61938771-61938793 GCTTCTGCTATATCTGTAATGGG - Intronic
1128563538 15:68683991-68684013 CCAGCTCCAAAATCTTCAATGGG - Intronic
1134253264 16:12589960-12589982 CCATCTGCTAAACCAGCAATGGG - Intergenic
1136613357 16:31380513-31380535 TCTTCTGCAATATCTGCAAAGGG - Exonic
1136620319 16:31424092-31424114 TCTTCTGCAATGTCTGCAAAGGG - Exonic
1144499237 17:15770903-15770925 CCAACTCCAAGAGCTGCAATTGG - Intergenic
1145162628 17:20585936-20585958 CCACCTCCAAGAGCTGCAATTGG - Intergenic
1145419631 17:22760917-22760939 CTATCTGTAAGATCTGCAAGCGG + Intergenic
1145419799 17:22763294-22763316 CTATCTGTAAGATCTGCAAGCGG + Intergenic
1145420548 17:22823824-22823846 CTATCTGTAAGATCTGCAAGTGG + Intergenic
1145432476 17:22987987-22988009 CTATCTGTAAGATCTGCAAGCGG + Intergenic
1145433423 17:23001068-23001090 CTATCTGTAAGATCTGCAAGCGG + Intergenic
1145435670 17:23032001-23032023 CTATCTGTAAGATCTGCAAGCGG + Intergenic
1145445661 17:23170024-23170046 CCATCTGTAGGATCTGCAAGCGG + Intergenic
1145446173 17:23177163-23177185 CTATCTGTAAGATCTGCAAGCGG + Intergenic
1146654849 17:34629024-34629046 CCAGCTGCAAGATCTCCAAGGGG - Exonic
1147796053 17:43043887-43043909 CCATCTTCAAAACCAGCAATGGG - Intergenic
1148246739 17:46036668-46036690 GTATCTGCAGTATCTGCAGTGGG - Intronic
1149091813 17:52792192-52792214 CCATCTTAAATATATGCCATAGG + Intergenic
1154254371 18:12769695-12769717 ACATCTGGAATAGCTGCAAGTGG - Intergenic
1154536212 18:15465745-15465767 CTTTCTGCAGTATCTGGAATTGG + Intergenic
1154540256 18:15525278-15525300 CCTTCTGCAGTATCTGGAAGTGG + Intergenic
1154542181 18:15552793-15552815 CCTTCTGCAGTATCTGGAAGTGG + Intergenic
1154548338 18:15642949-15642971 CTTTCTGCAGTATCTGGAATTGG + Intergenic
1154550787 18:15678695-15678717 CTTTCTGCAGTATCTGGAATTGG + Intergenic
1154551839 18:15694011-15694033 CTTTCTGCAGTATCTGGAATTGG + Intergenic
1154557754 18:15780291-15780313 CTTTCTGCAGTATCTGGAATTGG + Intergenic
1157175225 18:45445716-45445738 CCATCTGTGATATCTGCATAGGG - Intronic
1157342062 18:46787803-46787825 CCATCGGCACTTTCTGTAATTGG - Intergenic
1160386665 18:78501060-78501082 TCATCTGGAATATCTGCCAAAGG - Intergenic
1165136730 19:33674327-33674349 CCATCTGCAGGAGCTGCCATCGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1167840893 19:52118654-52118676 CAATCTACAATATCTACTATAGG + Intronic
926896670 2:17698063-17698085 TCATATGAAATATCTGGAATAGG + Intronic
931197980 2:60071475-60071497 CCAAATGAAATATCTGCAAATGG - Intergenic
932694566 2:73944392-73944414 CCATCTTCATTATCTTCATTGGG + Intronic
933549941 2:83763506-83763528 CCATCTCCACAATCTGGAATGGG + Intergenic
934337548 2:92211167-92211189 CTTTTTGTAATATCTGCAATAGG + Intergenic
934344863 2:92327257-92327279 CCTTTTGTAATATCTGCAAGAGG + Intergenic
934383552 2:92944255-92944277 CTTTTTGCAATATCTGCAAGAGG + Intergenic
934706790 2:96486900-96486922 CCATATGAAATGTCTACAATAGG - Intergenic
935820803 2:106890698-106890720 CCATTTTCAGTATCTGCAGTAGG + Intergenic
939532429 2:143381390-143381412 CCAACTGCAAAAGCAGCAATAGG - Intronic
940834252 2:158502694-158502716 CCATCTGCACCAATTGCAATTGG - Intronic
942403224 2:175625497-175625519 CCATTGGAAAAATCTGCAATTGG + Intergenic
944602832 2:201320859-201320881 CCAGCTGCAATAGTAGCAATAGG - Intronic
945517506 2:210780803-210780825 CCAATTGTAATATCTGCAGTTGG + Intergenic
947244259 2:228029636-228029658 CCATTTGCACTGTCTGCAAAGGG - Intronic
947259991 2:228210186-228210208 CCATCTCTAATATCTACAACAGG - Intergenic
1169919422 20:10718683-10718705 CCATCTGAAATTTCTTTAATGGG - Intergenic
1171005133 20:21457266-21457288 ACATCTGCCATCTCTGCATTTGG + Intergenic
1171181861 20:23096905-23096927 CCACCTGGAATATCTGCAGGTGG - Intergenic
1172990898 20:39035900-39035922 CCAGCTGAAATATCTGAATTGGG - Intronic
1173312409 20:41909745-41909767 CCATCTGCACTCTCTCCACTGGG - Intergenic
1173469265 20:43309967-43309989 CCATCTGAAATATCCACAAGAGG - Intergenic
1174041492 20:47703270-47703292 GTATCTGCAAAAACTGCAATGGG + Intronic
1174720192 20:52803407-52803429 CTATCTGCCATATCTGCTCTTGG + Intergenic
1174872064 20:54192236-54192258 CCATCTGCAATCTCTTCCAAAGG + Intergenic
1176323752 21:5365041-5365063 CTTTCTGTAGTATCTGCAATTGG + Intergenic
1176481514 21:7299044-7299066 CTTTCTGTAGTATCTGCAATTGG + Intergenic
1176513304 21:7764662-7764684 CCATCTGCAATATCTGCAATCGG - Intronic
1176517135 21:7794280-7794302 CCATCTGCCACACCTGCAACAGG - Intergenic
1177498335 21:21917804-21917826 TCATCTGCAATGTCTGAAAATGG - Intergenic
1178448637 21:32670336-32670358 CCAACTGATATATTTGCAATTGG - Exonic
1178647417 21:34395186-34395208 CCATCTGCAATATCTGCAATCGG - Intronic
1178651163 21:34424292-34424314 CCATCTGCCACACCTGCAACAGG - Intergenic
1179958145 21:44752374-44752396 CCATCTGCAGTAGCTGTAAAGGG - Intergenic
1182098373 22:27640982-27641004 TCATGTGAAATATCTACAATAGG - Intergenic
949548599 3:5093649-5093671 CCATTTGCAACGTCTGCTATTGG + Intergenic
950347026 3:12305525-12305547 ACATCTGCTATATCTGCATTTGG - Intronic
952754804 3:36856830-36856852 CCATCTGCAATGCCTACAACCGG - Exonic
956454520 3:69407752-69407774 TGATCAGCAATATCTGCCATAGG + Intronic
956638302 3:71389215-71389237 CCATATGCTATATCTGTAAGCGG + Intronic
958199044 3:90283609-90283631 CTTTCTGCAGTATCTGCAAATGG - Intergenic
958408913 3:93788987-93789009 CTTTCTGTAATATCTGCAAATGG - Intergenic
958667758 3:97162055-97162077 ACATCTGCAGCAGCTGCAATTGG + Intronic
959955312 3:112231006-112231028 CCAGTTGCAATTTCTACAATTGG + Intronic
962478822 3:135780844-135780866 ACTTCTGCAATACTTGCAATGGG - Intergenic
965053730 3:163686868-163686890 TCATCTGCATTATCTTCATTAGG + Intergenic
965401621 3:168219481-168219503 CCCTCTGTAACATCTGTAATGGG + Intergenic
967769416 3:193318115-193318137 CCATCTATAAAATATGCAATTGG - Intronic
972859221 4:43146787-43146809 CTATCTTCAATAACTGCATTTGG - Intergenic
973422280 4:50005617-50005639 CTTTCTGCACTATCTGCAAGCGG + Intergenic
973454412 4:50537810-50537832 CTTTCTGCACTATCTGCAAGCGG + Intergenic
973475020 4:50877001-50877023 CTTTCTGCACTATCTGCAAGTGG + Intergenic
973947007 4:55968152-55968174 CCATCTGCAATAGCATCAAAAGG + Intronic
978419066 4:108510942-108510964 CCATCTGGAATATATCCATTTGG + Intergenic
983032120 4:162815639-162815661 ACACCTGCAATGTCAGCAATTGG - Intergenic
984823244 4:183902903-183902925 CCCTCTGCAAGGTCTGCATTTGG + Intronic
987810938 5:22835350-22835372 CCATCTGCAATATTTCCTTTAGG - Intronic
988386924 5:30576780-30576802 CCATCTACAGAATATGCAATAGG - Intergenic
989115851 5:37951716-37951738 ACTTCTGCAATATCTGCACAGGG - Intergenic
989149342 5:38283212-38283234 CCTTCCAGAATATCTGCAATTGG - Intronic
989859976 5:46359499-46359521 CTATCTGCAGAATCTGCAAGAGG - Intergenic
994552271 5:101251562-101251584 CTATCTGAAATATCTAAAATAGG + Intergenic
995101301 5:108310231-108310253 CCGTCTTCAATATATGCAAAAGG + Intronic
995273797 5:110255408-110255430 CCATCTGCAACATCCCCAGTGGG - Intergenic
995780286 5:115767931-115767953 CCATCTGCAATCTGTGCAAGAGG + Intergenic
999982608 5:156972283-156972305 CCATTTGCAGTTTCAGCAATTGG + Intergenic
1000044957 5:157514671-157514693 CCATTAGAAATATCTGCCATGGG + Intronic
1000278880 5:159764880-159764902 CCATCTGCATTATTTGCATGGGG - Intergenic
1000677417 5:164138280-164138302 CCATCTGAAATACCTAAAATTGG + Intergenic
1005437224 6:25827547-25827569 CCATCTCCAAAATCAGCAATGGG + Intronic
1008883339 6:56404903-56404925 ACATATGCATTATCTGCAATTGG - Intergenic
1012518934 6:100097038-100097060 CCATCTGCAAAACCAGCAGTGGG + Intergenic
1013187098 6:107769046-107769068 CCATTTGAAACATCTGCTATTGG - Intronic
1014918662 6:127185297-127185319 CAATCTGCATTACCTGCTATAGG + Intronic
1019181855 6:170192391-170192413 CCATCTGCTTTAGCTGCACTTGG - Intergenic
1020996926 7:15277705-15277727 CCATCTGCTTTTACTGCAATTGG - Intronic
1024772207 7:52736512-52736534 CCATCTTGAACATCTGCACTTGG - Intergenic
1024967463 7:55036855-55036877 CCTTCTGCAGTTTCTGCAGTTGG - Intronic
1025355608 7:58745601-58745623 CTATTTGTAATGTCTGCAATTGG + Intergenic
1025421796 7:59919510-59919532 CTATTTGTAATGTCTGCAATTGG + Intergenic
1025501480 7:61305934-61305956 CGATCTGTAGAATCTGCAATGGG - Intergenic
1025516344 7:61652157-61652179 CAATCTGTAGAATCTGCAATGGG - Intergenic
1025532692 7:61909241-61909263 CCATGTGCAGAATCTGCAAAGGG + Intergenic
1025540679 7:62080983-62081005 CAATCTGTAGAATCTGCAATGGG - Intergenic
1025545087 7:62155379-62155401 CTTTTTGCAATATCTGCAAAGGG - Intergenic
1028047857 7:86145992-86146014 CAATCTGCAATAGCTGGAAGTGG - Intergenic
1028470211 7:91197531-91197553 TCTTCTGAAATATCTGCAATAGG - Intronic
1028700717 7:93775942-93775964 CCAACTGCAGTATCTGCTTTGGG - Intronic
1030079327 7:105763604-105763626 TCATCTGCAATTTCTGCAAAAGG + Intronic
1030948679 7:115760967-115760989 CCATGTTCAATATCTGCTAAAGG - Intergenic
1034128262 7:148693505-148693527 CAATATGCAAGATCTGAAATTGG + Intergenic
1034383006 7:150715528-150715550 CCACCTACAAGATCTGCACTTGG + Intergenic
1038999611 8:32965137-32965159 CCATATGTGATATCTGGAATGGG + Intergenic
1042852592 8:73231282-73231304 GCATCTGCAATATCAGAAGTTGG + Intergenic
1043123175 8:76357212-76357234 CCAAATACAGTATCTGCAATTGG - Intergenic
1045488334 8:102651535-102651557 CCACCTGCAGTATCTGCAGGGGG - Exonic
1046918853 8:119706134-119706156 CCATCAGCAGTCTCTGCTATAGG + Intergenic
1048243111 8:132764175-132764197 CCATCTCCACTATCTGCTCTAGG + Intergenic
1048689516 8:136945131-136945153 ACATCTGCAATATAAGGAATTGG - Intergenic
1049592262 8:143468033-143468055 CCAGCTGCAAAGCCTGCAATGGG + Intronic
1051025302 9:12603076-12603098 CCAGCTGCAATGTCTAGAATTGG - Intergenic
1051213349 9:14769324-14769346 CCTTCTAAAATATCTGCAGTCGG - Intronic
1051379965 9:16446998-16447020 CTTTCTGCAATGTCTGGAATTGG + Intronic
1051890842 9:21941178-21941200 CCCTGTACAATATCTGCCATTGG + Intronic
1051937432 9:22460017-22460039 CCATCTTCACTTTCTGCAAGAGG + Intergenic
1053381521 9:37652902-37652924 CCTTCTCCAATATCTCCACTTGG - Intronic
1053954516 9:43445734-43445756 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1053973587 9:43776356-43776378 CTTTCTGCAGTATCTGCAAACGG + Intergenic
1054005884 9:44338305-44338327 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054007719 9:44370127-44370149 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054008543 9:44384591-44384613 CCTTCTGTAGTATCTGCAAACGG + Intergenic
1054019538 9:44574110-44574132 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054019614 9:44575470-44575492 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054021802 9:44612707-44612729 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054033278 9:44809347-44809369 CTTTCTGCAGTATCTGCAAGCGG + Intergenic
1054035025 9:44839446-44839468 CTTTCTGCAGTATCTGCAAGCGG + Intergenic
1054035422 9:44846244-44846266 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054039923 9:44923034-44923056 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054048425 9:45067456-45067478 CCTTCTGTAGTATCTGCAAACGG + Intergenic
1054050432 9:45100966-45100988 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054050682 9:45105042-45105064 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054052932 9:45142796-45142818 CTTTCTGTAATATCTGCAAGCGG + Intergenic
1054053477 9:45152154-45152176 CTTTCTGTAATATCTGCAAGCGG + Intergenic
1054055933 9:45194502-45194524 CCTTCTGTAGTATCTGCAAGCGG + Intergenic
1054061757 9:45294501-45294523 CTATCTGTAGTATCTGCAAGCGG + Intergenic
1054078337 9:60567576-60567598 CTATCTGTAGTATCTGCAAGCGG - Intergenic
1054081315 9:60617925-60617947 CCTTCTGTAGTATCTGCAAGCGG - Intergenic
1054081355 9:60618604-60618626 CTTTCTGTAGTATCTGCAATCGG - Intergenic
1054082340 9:60635449-60635471 CCTTCTGTAGTATCTGCAAGCGG - Intergenic
1054083309 9:60652631-60652653 CCTTCTGTAGTATCTGCAAGCGG - Intergenic
1054083990 9:60664355-60664377 CTTTCTGTAGTATCTGCAATCGG - Intergenic
1054084344 9:60670481-60670503 CTTTCTGTAGTATCTGCAATCGG - Intergenic
1054424330 9:64992397-64992419 CCTTTTGCAGTATCTGCAAGCGG + Intergenic
1056255678 9:84796527-84796549 CAATCTACAATATCTGCCAAAGG + Intronic
1203400793 Un_KI270519v1:93965-93987 CTTTTTGCAATATCTGCAAATGG + Intergenic
1203400929 Un_KI270519v1:96516-96538 CTTTCTGCAGTATCTGCAAATGG + Intergenic
1203594384 Un_KI270747v1:110742-110764 CTTTCTGCAGTATCTGCAAGCGG + Intergenic
1187909708 X:24100126-24100148 CCATCTTCAAAGTCAGCAATAGG + Intergenic
1187957996 X:24539510-24539532 CGATCTGCTGTATCTGGAATGGG - Exonic
1190296329 X:49029932-49029954 CCTTCTGAAATACCTGCACTGGG + Exonic
1190978643 X:55433449-55433471 CCATCTGCTTTATCTCCACTGGG + Intergenic
1191574151 X:62676444-62676466 CCATTTGCAGAATCTGCAAAGGG + Intergenic
1194862897 X:99026273-99026295 CCACCTGCAAAATATGAAATTGG - Intergenic
1199079966 X:143566275-143566297 ATATCTGAAATATCTGAAATTGG + Intergenic
1199542088 X:148968456-148968478 CGTTCTCAAATATCTGCAATTGG - Intronic
1200584879 Y:4996478-4996500 CCATCAGCAACAATTGCAATAGG - Intergenic
1201079657 Y:10226507-10226529 CTTTCTGTAATATCTGCAAATGG - Intergenic