ID: 1176515690

View in Genome Browser
Species Human (GRCh38)
Location 21:7781769-7781791
Sequence GCCATGGGCCCTGTGTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176515689_1176515690 -10 Left 1176515689 21:7781756-7781778 CCTGGAGGCGTGTGCCATGGGCC No data
Right 1176515690 21:7781769-7781791 GCCATGGGCCCTGTGTGCCATGG No data
1176515682_1176515690 18 Left 1176515682 21:7781728-7781750 CCACACCACAGCCTCTCTGGGGC No data
Right 1176515690 21:7781769-7781791 GCCATGGGCCCTGTGTGCCATGG No data
1176515683_1176515690 13 Left 1176515683 21:7781733-7781755 CCACAGCCTCTCTGGGGCTGTGT No data
Right 1176515690 21:7781769-7781791 GCCATGGGCCCTGTGTGCCATGG No data
1176515685_1176515690 7 Left 1176515685 21:7781739-7781761 CCTCTCTGGGGCTGTGTCCTGGA No data
Right 1176515690 21:7781769-7781791 GCCATGGGCCCTGTGTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176515690 Original CRISPR GCCATGGGCCCTGTGTGCCA TGG Intergenic
No off target data available for this crispr