ID: 1176524285

View in Genome Browser
Species Human (GRCh38)
Location 21:7853688-7853710
Sequence CTAAATATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176524285_1176524290 15 Left 1176524285 21:7853688-7853710 CCATTGTCCATTTGTATATTTAG No data
Right 1176524290 21:7853726-7853748 AAGCCGAAAAGGAGATTGAAAGG No data
1176524285_1176524289 4 Left 1176524285 21:7853688-7853710 CCATTGTCCATTTGTATATTTAG No data
Right 1176524289 21:7853715-7853737 TTGGGAGAAAAAAGCCGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176524285 Original CRISPR CTAAATATACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr