ID: 1176525370

View in Genome Browser
Species Human (GRCh38)
Location 21:7862595-7862617
Sequence GCTGATTACAAGTCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176525370_1176525380 18 Left 1176525370 21:7862595-7862617 CCTGCTTTTGACTTGTAATCAGC No data
Right 1176525380 21:7862636-7862658 TGGTTCCCTTTCCTGGGGAATGG No data
1176525370_1176525377 13 Left 1176525370 21:7862595-7862617 CCTGCTTTTGACTTGTAATCAGC No data
Right 1176525377 21:7862631-7862653 ATCCCTGGTTCCCTTTCCTGGGG No data
1176525370_1176525375 11 Left 1176525370 21:7862595-7862617 CCTGCTTTTGACTTGTAATCAGC No data
Right 1176525375 21:7862629-7862651 GGATCCCTGGTTCCCTTTCCTGG No data
1176525370_1176525372 -10 Left 1176525370 21:7862595-7862617 CCTGCTTTTGACTTGTAATCAGC No data
Right 1176525372 21:7862608-7862630 TGTAATCAGCCGGTTCAATGAGG No data
1176525370_1176525373 -2 Left 1176525370 21:7862595-7862617 CCTGCTTTTGACTTGTAATCAGC No data
Right 1176525373 21:7862616-7862638 GCCGGTTCAATGAGGATCCCTGG No data
1176525370_1176525376 12 Left 1176525370 21:7862595-7862617 CCTGCTTTTGACTTGTAATCAGC No data
Right 1176525376 21:7862630-7862652 GATCCCTGGTTCCCTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176525370 Original CRISPR GCTGATTACAAGTCAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr