ID: 1176538587

View in Genome Browser
Species Human (GRCh38)
Location 21:8125513-8125535
Sequence GTCAGGTTACCTACAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176538587_1176538592 25 Left 1176538587 21:8125513-8125535 CCTCCATTTGTAGGTAACCTGAC No data
Right 1176538592 21:8125561-8125583 TATTTCCTTCATTTCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176538587 Original CRISPR GTCAGGTTACCTACAAATGG AGG (reversed) Intergenic
No off target data available for this crispr