ID: 1176541822

View in Genome Browser
Species Human (GRCh38)
Location 21:8161427-8161449
Sequence AAGGGGAATCAGCAAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176541822_1176541827 16 Left 1176541822 21:8161427-8161449 CCATCTCCTTGCTGATTCCCCTT No data
Right 1176541827 21:8161466-8161488 TCTCTCTCTATTCCTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176541822 Original CRISPR AAGGGGAATCAGCAAGGAGA TGG (reversed) Intergenic
No off target data available for this crispr