ID: 1176543938

View in Genome Browser
Species Human (GRCh38)
Location 21:8180189-8180211
Sequence CAACTAGGATTGGTGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176543938_1176543944 13 Left 1176543938 21:8180189-8180211 CCTTGCTACACCAATCCTAGTTG No data
Right 1176543944 21:8180225-8180247 ACCATATGCATGTTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176543938 Original CRISPR CAACTAGGATTGGTGTAGCA AGG (reversed) Intergenic
No off target data available for this crispr