ID: 1176543944

View in Genome Browser
Species Human (GRCh38)
Location 21:8180225-8180247
Sequence ACCATATGCATGTTGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176543943_1176543944 -2 Left 1176543943 21:8180204-8180226 CCTAGTTGGTAGGGACGTTAGAC No data
Right 1176543944 21:8180225-8180247 ACCATATGCATGTTGAGCTGTGG No data
1176543942_1176543944 3 Left 1176543942 21:8180199-8180221 CCAATCCTAGTTGGTAGGGACGT No data
Right 1176543944 21:8180225-8180247 ACCATATGCATGTTGAGCTGTGG No data
1176543938_1176543944 13 Left 1176543938 21:8180189-8180211 CCTTGCTACACCAATCCTAGTTG No data
Right 1176543944 21:8180225-8180247 ACCATATGCATGTTGAGCTGTGG No data
1176543936_1176543944 25 Left 1176543936 21:8180177-8180199 CCCTGATCACAGCCTTGCTACAC No data
Right 1176543944 21:8180225-8180247 ACCATATGCATGTTGAGCTGTGG No data
1176543937_1176543944 24 Left 1176543937 21:8180178-8180200 CCTGATCACAGCCTTGCTACACC No data
Right 1176543944 21:8180225-8180247 ACCATATGCATGTTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176543944 Original CRISPR ACCATATGCATGTTGAGCTG TGG Intergenic
No off target data available for this crispr