ID: 1176544000

View in Genome Browser
Species Human (GRCh38)
Location 21:8180639-8180661
Sequence CAGGACCCATAACATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176543993_1176544000 -3 Left 1176543993 21:8180619-8180641 CCATCTTCTGGTAACATGCCCAG No data
Right 1176544000 21:8180639-8180661 CAGGACCCATAACATGGGCAGGG No data
1176543991_1176544000 -1 Left 1176543991 21:8180617-8180639 CCCCATCTTCTGGTAACATGCCC No data
Right 1176544000 21:8180639-8180661 CAGGACCCATAACATGGGCAGGG No data
1176543992_1176544000 -2 Left 1176543992 21:8180618-8180640 CCCATCTTCTGGTAACATGCCCA No data
Right 1176544000 21:8180639-8180661 CAGGACCCATAACATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176544000 Original CRISPR CAGGACCCATAACATGGGCA GGG Intergenic
No off target data available for this crispr