ID: 1176547011

View in Genome Browser
Species Human (GRCh38)
Location 21:8206499-8206521
Sequence GCGGGGCGGAGCGAGAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547011_1176547025 16 Left 1176547011 21:8206499-8206521 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176547025 21:8206538-8206560 CTCCTCTCCCCGCCCGCCGGCGG No data
1176547011_1176547031 26 Left 1176547011 21:8206499-8206521 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176547031 21:8206548-8206570 CGCCCGCCGGCGGTGCGTGTGGG No data
1176547011_1176547024 13 Left 1176547011 21:8206499-8206521 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data
1176547011_1176547034 30 Left 1176547011 21:8206499-8206521 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176547034 21:8206552-8206574 CGCCGGCGGTGCGTGTGGGAAGG No data
1176547011_1176547030 25 Left 1176547011 21:8206499-8206521 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176547030 21:8206547-8206569 CCGCCCGCCGGCGGTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547011 Original CRISPR GCGGGGCGGAGCGAGAAGGA CGG (reversed) Intergenic
No off target data available for this crispr