ID: 1176547017

View in Genome Browser
Species Human (GRCh38)
Location 21:8206513-8206535
Sequence ACGAGGGGACCCCCGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547017_1176547037 22 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547037 21:8206558-8206580 CGGTGCGTGTGGGAAGGCGTGGG No data
1176547017_1176547036 21 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547017_1176547025 2 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547025 21:8206538-8206560 CTCCTCTCCCCGCCCGCCGGCGG No data
1176547017_1176547030 11 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547030 21:8206547-8206569 CCGCCCGCCGGCGGTGCGTGTGG No data
1176547017_1176547034 16 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547034 21:8206552-8206574 CGCCGGCGGTGCGTGTGGGAAGG No data
1176547017_1176547039 28 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547039 21:8206564-8206586 GTGTGGGAAGGCGTGGGGTGCGG No data
1176547017_1176547031 12 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547031 21:8206548-8206570 CGCCCGCCGGCGGTGCGTGTGGG No data
1176547017_1176547024 -1 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data
1176547017_1176547038 23 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547038 21:8206559-8206581 GGTGCGTGTGGGAAGGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547017 Original CRISPR ACGAGGGGACCCCCGCGGGG CGG (reversed) Intergenic
No off target data available for this crispr