ID: 1176547022

View in Genome Browser
Species Human (GRCh38)
Location 21:8206529-8206551
Sequence GGCGGGGAGAGGAGAGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547022_1176547031 -4 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547031 21:8206548-8206570 CGCCCGCCGGCGGTGCGTGTGGG No data
1176547022_1176547039 12 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547039 21:8206564-8206586 GTGTGGGAAGGCGTGGGGTGCGG No data
1176547022_1176547030 -5 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547030 21:8206547-8206569 CCGCCCGCCGGCGGTGCGTGTGG No data
1176547022_1176547038 7 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547038 21:8206559-8206581 GGTGCGTGTGGGAAGGCGTGGGG No data
1176547022_1176547037 6 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547037 21:8206558-8206580 CGGTGCGTGTGGGAAGGCGTGGG No data
1176547022_1176547040 19 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547022_1176547034 0 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547034 21:8206552-8206574 CGCCGGCGGTGCGTGTGGGAAGG No data
1176547022_1176547036 5 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547022 Original CRISPR GGCGGGGAGAGGAGAGACGA GGG (reversed) Intergenic
No off target data available for this crispr