ID: 1176547023

View in Genome Browser
Species Human (GRCh38)
Location 21:8206530-8206552
Sequence GGGCGGGGAGAGGAGAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547023_1176547040 18 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547023_1176547038 6 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547038 21:8206559-8206581 GGTGCGTGTGGGAAGGCGTGGGG No data
1176547023_1176547031 -5 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547031 21:8206548-8206570 CGCCCGCCGGCGGTGCGTGTGGG No data
1176547023_1176547034 -1 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547034 21:8206552-8206574 CGCCGGCGGTGCGTGTGGGAAGG No data
1176547023_1176547039 11 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547039 21:8206564-8206586 GTGTGGGAAGGCGTGGGGTGCGG No data
1176547023_1176547030 -6 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547030 21:8206547-8206569 CCGCCCGCCGGCGGTGCGTGTGG No data
1176547023_1176547037 5 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547037 21:8206558-8206580 CGGTGCGTGTGGGAAGGCGTGGG No data
1176547023_1176547036 4 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547023 Original CRISPR GGGCGGGGAGAGGAGAGACG AGG (reversed) Intergenic