ID: 1176547024

View in Genome Browser
Species Human (GRCh38)
Location 21:8206535-8206557
Sequence TCTCTCCTCTCCCCGCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547018_1176547024 -4 Left 1176547018 21:8206516-8206538 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data
1176547014_1176547024 9 Left 1176547014 21:8206503-8206525 CCTTCTCGCTCCGCCCCGCGGGG No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data
1176547020_1176547024 -6 Left 1176547020 21:8206518-8206540 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data
1176547019_1176547024 -5 Left 1176547019 21:8206517-8206539 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data
1176547017_1176547024 -1 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data
1176547011_1176547024 13 Left 1176547011 21:8206499-8206521 CCGTCCTTCTCGCTCCGCCCCGC No data
Right 1176547024 21:8206535-8206557 TCTCTCCTCTCCCCGCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547024 Original CRISPR TCTCTCCTCTCCCCGCCCGC CGG Intergenic
No off target data available for this crispr