ID: 1176547026

View in Genome Browser
Species Human (GRCh38)
Location 21:8206540-8206562
Sequence CACCGCCGGCGGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547026_1176547037 -5 Left 1176547026 21:8206540-8206562 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176547037 21:8206558-8206580 CGGTGCGTGTGGGAAGGCGTGGG No data
1176547026_1176547040 8 Left 1176547026 21:8206540-8206562 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547026_1176547039 1 Left 1176547026 21:8206540-8206562 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176547039 21:8206564-8206586 GTGTGGGAAGGCGTGGGGTGCGG No data
1176547026_1176547038 -4 Left 1176547026 21:8206540-8206562 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176547038 21:8206559-8206581 GGTGCGTGTGGGAAGGCGTGGGG No data
1176547026_1176547036 -6 Left 1176547026 21:8206540-8206562 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547026 Original CRISPR CACCGCCGGCGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr