ID: 1176547032

View in Genome Browser
Species Human (GRCh38)
Location 21:8206550-8206572
Sequence TTCCCACACGCACCGCCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547032_1176547039 -9 Left 1176547032 21:8206550-8206572 CCCGCCGGCGGTGCGTGTGGGAA No data
Right 1176547039 21:8206564-8206586 GTGTGGGAAGGCGTGGGGTGCGG No data
1176547032_1176547040 -2 Left 1176547032 21:8206550-8206572 CCCGCCGGCGGTGCGTGTGGGAA No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547032 Original CRISPR TTCCCACACGCACCGCCGGC GGG (reversed) Intergenic
No off target data available for this crispr