ID: 1176547033

View in Genome Browser
Species Human (GRCh38)
Location 21:8206551-8206573
Sequence CTTCCCACACGCACCGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547033_1176547040 -3 Left 1176547033 21:8206551-8206573 CCGCCGGCGGTGCGTGTGGGAAG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547033_1176547039 -10 Left 1176547033 21:8206551-8206573 CCGCCGGCGGTGCGTGTGGGAAG No data
Right 1176547039 21:8206564-8206586 GTGTGGGAAGGCGTGGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547033 Original CRISPR CTTCCCACACGCACCGCCGG CGG (reversed) Intergenic
No off target data available for this crispr