ID: 1176547035

View in Genome Browser
Species Human (GRCh38)
Location 21:8206554-8206576
Sequence CGCCTTCCCACACGCACCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547035_1176547040 -6 Left 1176547035 21:8206554-8206576 CCGGCGGTGCGTGTGGGAAGGCG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547035 Original CRISPR CGCCTTCCCACACGCACCGC CGG (reversed) Intergenic
No off target data available for this crispr