ID: 1176547036

View in Genome Browser
Species Human (GRCh38)
Location 21:8206557-8206579
Sequence GCGGTGCGTGTGGGAAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547017_1176547036 21 Left 1176547017 21:8206513-8206535 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547021_1176547036 6 Left 1176547021 21:8206528-8206550 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547022_1176547036 5 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547019_1176547036 17 Left 1176547019 21:8206517-8206539 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547018_1176547036 18 Left 1176547018 21:8206516-8206538 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547023_1176547036 4 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547020_1176547036 16 Left 1176547020 21:8206518-8206540 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data
1176547026_1176547036 -6 Left 1176547026 21:8206540-8206562 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547036 Original CRISPR GCGGTGCGTGTGGGAAGGCG TGG Intergenic
No off target data available for this crispr