ID: 1176547040

View in Genome Browser
Species Human (GRCh38)
Location 21:8206571-8206593
Sequence AAGGCGTGGGGTGCGGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547027_1176547040 3 Left 1176547027 21:8206545-8206567 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547023_1176547040 18 Left 1176547023 21:8206530-8206552 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547022_1176547040 19 Left 1176547022 21:8206529-8206551 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547035_1176547040 -6 Left 1176547035 21:8206554-8206576 CCGGCGGTGCGTGTGGGAAGGCG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547028_1176547040 2 Left 1176547028 21:8206546-8206568 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547026_1176547040 8 Left 1176547026 21:8206540-8206562 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547029_1176547040 1 Left 1176547029 21:8206547-8206569 CCGCCCGCCGGCGGTGCGTGTGG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547032_1176547040 -2 Left 1176547032 21:8206550-8206572 CCCGCCGGCGGTGCGTGTGGGAA No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547033_1176547040 -3 Left 1176547033 21:8206551-8206573 CCGCCGGCGGTGCGTGTGGGAAG No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547020_1176547040 30 Left 1176547020 21:8206518-8206540 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data
1176547021_1176547040 20 Left 1176547021 21:8206528-8206550 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1176547040 21:8206571-8206593 AAGGCGTGGGGTGCGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547040 Original CRISPR AAGGCGTGGGGTGCGGACCC CGG Intergenic
No off target data available for this crispr