ID: 1176547868

View in Genome Browser
Species Human (GRCh38)
Location 21:8209210-8209232
Sequence GCGGCGCCCCGACGTCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547868_1176547878 16 Left 1176547868 21:8209210-8209232 CCGCCCGGACGTCGGGGCGCCGC No data
Right 1176547878 21:8209249-8209271 GTCCCCGCCTCGCGCGCCCGCGG No data
1176547868_1176547885 24 Left 1176547868 21:8209210-8209232 CCGCCCGGACGTCGGGGCGCCGC No data
Right 1176547885 21:8209257-8209279 CTCGCGCGCCCGCGGGCGCCGGG No data
1176547868_1176547879 17 Left 1176547868 21:8209210-8209232 CCGCCCGGACGTCGGGGCGCCGC No data
Right 1176547879 21:8209250-8209272 TCCCCGCCTCGCGCGCCCGCGGG No data
1176547868_1176547886 25 Left 1176547868 21:8209210-8209232 CCGCCCGGACGTCGGGGCGCCGC No data
Right 1176547886 21:8209258-8209280 TCGCGCGCCCGCGGGCGCCGGGG No data
1176547868_1176547884 23 Left 1176547868 21:8209210-8209232 CCGCCCGGACGTCGGGGCGCCGC No data
Right 1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547868 Original CRISPR GCGGCGCCCCGACGTCCGGG CGG (reversed) Intergenic
No off target data available for this crispr