ID: 1176547884

View in Genome Browser
Species Human (GRCh38)
Location 21:8209256-8209278
Sequence CCTCGCGCGCCCGCGGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176547876_1176547884 4 Left 1176547876 21:8209229-8209251 CCGCGGGGCGGCGGAGCGCCGTC No data
Right 1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG No data
1176547868_1176547884 23 Left 1176547868 21:8209210-8209232 CCGCCCGGACGTCGGGGCGCCGC No data
Right 1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG No data
1176547870_1176547884 20 Left 1176547870 21:8209213-8209235 CCCGGACGTCGGGGCGCCGCGGG No data
Right 1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG No data
1176547872_1176547884 19 Left 1176547872 21:8209214-8209236 CCGGACGTCGGGGCGCCGCGGGG No data
Right 1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176547884 Original CRISPR CCTCGCGCGCCCGCGGGCGC CGG Intergenic
No off target data available for this crispr