ID: 1176548599

View in Genome Browser
Species Human (GRCh38)
Location 21:8212238-8212260
Sequence GACGGCCGCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176548599_1176548611 -1 Left 1176548599 21:8212238-8212260 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176548611 21:8212260-8212282 CGGGTGGGGGCTTTACCCGGCGG No data
1176548599_1176548610 -4 Left 1176548599 21:8212238-8212260 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176548610 21:8212257-8212279 CGTCGGGTGGGGGCTTTACCCGG No data
1176548599_1176548615 25 Left 1176548599 21:8212238-8212260 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1176548615 21:8212286-8212308 TCGCGCGCCTGCCGCGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176548599 Original CRISPR GACGGCCGCCGCGGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr