ID: 1176548616

View in Genome Browser
Species Human (GRCh38)
Location 21:8212293-8212315
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176548616_1176548621 -8 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548621 21:8212308-8212330 GCGTGCGCCCCGCGCCGTGGGGG No data
1176548616_1176548627 5 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548627 21:8212321-8212343 GCCGTGGGGGCGGGAACCCCCGG No data
1176548616_1176548622 -5 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548622 21:8212311-8212333 TGCGCCCCGCGCCGTGGGGGCGG No data
1176548616_1176548633 20 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548633 21:8212336-8212358 ACCCCCGGGCGCCTGTGGGGTGG No data
1176548616_1176548620 -9 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548620 21:8212307-8212329 GGCGTGCGCCCCGCGCCGTGGGG No data
1176548616_1176548619 -10 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548619 21:8212306-8212328 TGGCGTGCGCCCCGCGCCGTGGG No data
1176548616_1176548630 15 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548630 21:8212331-8212353 CGGGAACCCCCGGGCGCCTGTGG No data
1176548616_1176548631 16 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548631 21:8212332-8212354 GGGAACCCCCGGGCGCCTGTGGG No data
1176548616_1176548629 6 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548629 21:8212322-8212344 CCGTGGGGGCGGGAACCCCCGGG No data
1176548616_1176548623 -4 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548623 21:8212312-8212334 GCGCCCCGCGCCGTGGGGGCGGG No data
1176548616_1176548632 17 Left 1176548616 21:8212293-8212315 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1176548632 21:8212333-8212355 GGAACCCCCGGGCGCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176548616 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic