ID: 1176549491

View in Genome Browser
Species Human (GRCh38)
Location 21:8214997-8215019
Sequence CGTCGCCGGGGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176549491_1176549518 13 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549518 21:8215033-8215055 GCGCGGGTCGGGGGGCGGGGCGG No data
1176549491_1176549513 5 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549513 21:8215025-8215047 GGTGCCGCGCGCGGGTCGGGGGG No data
1176549491_1176549510 2 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549510 21:8215022-8215044 GGGGGTGCCGCGCGCGGGTCGGG No data
1176549491_1176549514 8 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549514 21:8215028-8215050 GCCGCGCGCGGGTCGGGGGGCGG No data
1176549491_1176549511 3 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549511 21:8215023-8215045 GGGGTGCCGCGCGCGGGTCGGGG No data
1176549491_1176549509 1 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549509 21:8215021-8215043 GGGGGGTGCCGCGCGCGGGTCGG No data
1176549491_1176549517 10 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549517 21:8215030-8215052 CGCGCGCGGGTCGGGGGGCGGGG No data
1176549491_1176549516 9 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549516 21:8215029-8215051 CCGCGCGCGGGTCGGGGGGCGGG No data
1176549491_1176549508 -3 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549508 21:8215017-8215039 ACGGGGGGGGTGCCGCGCGCGGG No data
1176549491_1176549512 4 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549512 21:8215024-8215046 GGGTGCCGCGCGCGGGTCGGGGG No data
1176549491_1176549507 -4 Left 1176549491 21:8214997-8215019 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1176549507 21:8215016-8215038 GACGGGGGGGGTGCCGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176549491 Original CRISPR CGTCGCCGGGGCGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr