ID: 1176549845

View in Genome Browser
Species Human (GRCh38)
Location 21:8216464-8216486
Sequence CCGATCCCGGAGAAGCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176549836_1176549845 26 Left 1176549836 21:8216415-8216437 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1176549845 21:8216464-8216486 CCGATCCCGGAGAAGCCGGCGGG No data
1176549840_1176549845 -6 Left 1176549840 21:8216447-8216469 CCAGTGCGGTAACGCGACCGATC No data
Right 1176549845 21:8216464-8216486 CCGATCCCGGAGAAGCCGGCGGG No data
1176549839_1176549845 5 Left 1176549839 21:8216436-8216458 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1176549845 21:8216464-8216486 CCGATCCCGGAGAAGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176549845 Original CRISPR CCGATCCCGGAGAAGCCGGC GGG Intergenic
No off target data available for this crispr