ID: 1176550108

View in Genome Browser
Species Human (GRCh38)
Location 21:8217233-8217255
Sequence GCGCGCGCGTCCGCTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176550090_1176550108 21 Left 1176550090 21:8217189-8217211 CCGGCGGGCGCCGGCGCGNCCCC 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550094_1176550108 0 Left 1176550094 21:8217210-8217232 CCCCCCCCACCCCACGTCTCGTC No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550097_1176550108 -3 Left 1176550097 21:8217213-8217235 CCCCCACCCCACGTCTCGTCGCG No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550089_1176550108 22 Left 1176550089 21:8217188-8217210 CCCGGCGGGCGCCGGCGCGNCCC 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550095_1176550108 -1 Left 1176550095 21:8217211-8217233 CCCCCCCACCCCACGTCTCGTCG No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550100_1176550108 -6 Left 1176550100 21:8217216-8217238 CCACCCCACGTCTCGTCGCGCGC No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550099_1176550108 -5 Left 1176550099 21:8217215-8217237 CCCACCCCACGTCTCGTCGCGCG No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550092_1176550108 2 Left 1176550092 21:8217208-8217230 CCCCCCCCCCACCCCACGTCTCG No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550093_1176550108 1 Left 1176550093 21:8217209-8217231 CCCCCCCCCACCCCACGTCTCGT No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550087_1176550108 30 Left 1176550087 21:8217180-8217202 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550098_1176550108 -4 Left 1176550098 21:8217214-8217236 CCCCACCCCACGTCTCGTCGCGC No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550096_1176550108 -2 Left 1176550096 21:8217212-8217234 CCCCCCACCCCACGTCTCGTCGC No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550102_1176550108 -10 Left 1176550102 21:8217220-8217242 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550091_1176550108 11 Left 1176550091 21:8217199-8217221 CCGGCGCGNCCCCCCCCCCACCC 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data
1176550101_1176550108 -9 Left 1176550101 21:8217219-8217241 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176550108 Original CRISPR GCGCGCGCGTCCGCTGGGGG CGG Intergenic
No off target data available for this crispr