ID: 1176550490

View in Genome Browser
Species Human (GRCh38)
Location 21:8218921-8218943
Sequence CGGACAAACCCTTGTGTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176550490_1176550496 5 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG No data
1176550490_1176550499 14 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550499 21:8218958-8218980 CGTGCGTGCGGGGGGCCCGGCGG No data
1176550490_1176550498 11 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550498 21:8218955-8218977 GCGCGTGCGTGCGGGGGGCCCGG No data
1176550490_1176550493 2 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550493 21:8218946-8218968 CGCGCGCGCGCGCGTGCGTGCGG No data
1176550490_1176550494 3 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG No data
1176550490_1176550495 4 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550495 21:8218948-8218970 CGCGCGCGCGCGTGCGTGCGGGG No data
1176550490_1176550497 6 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550497 21:8218950-8218972 CGCGCGCGCGTGCGTGCGGGGGG No data
1176550490_1176550503 29 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550503 21:8218973-8218995 CCCGGCGGGGCGTGCGCGTCCGG No data
1176550490_1176550501 16 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550501 21:8218960-8218982 TGCGTGCGGGGGGCCCGGCGGGG No data
1176550490_1176550500 15 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550500 21:8218959-8218981 GTGCGTGCGGGGGGCCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176550490 Original CRISPR CGGACAAACCCTTGTGTCGA GGG (reversed) Intergenic