ID: 1176550491

View in Genome Browser
Species Human (GRCh38)
Location 21:8218922-8218944
Sequence GCGGACAAACCCTTGTGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176550491_1176550497 5 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550497 21:8218950-8218972 CGCGCGCGCGTGCGTGCGGGGGG No data
1176550491_1176550501 15 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550501 21:8218960-8218982 TGCGTGCGGGGGGCCCGGCGGGG No data
1176550491_1176550498 10 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550498 21:8218955-8218977 GCGCGTGCGTGCGGGGGGCCCGG No data
1176550491_1176550493 1 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550493 21:8218946-8218968 CGCGCGCGCGCGCGTGCGTGCGG No data
1176550491_1176550499 13 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550499 21:8218958-8218980 CGTGCGTGCGGGGGGCCCGGCGG No data
1176550491_1176550500 14 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550500 21:8218959-8218981 GTGCGTGCGGGGGGCCCGGCGGG No data
1176550491_1176550494 2 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG No data
1176550491_1176550495 3 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550495 21:8218948-8218970 CGCGCGCGCGCGTGCGTGCGGGG No data
1176550491_1176550496 4 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG No data
1176550491_1176550503 28 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550503 21:8218973-8218995 CCCGGCGGGGCGTGCGCGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176550491 Original CRISPR GCGGACAAACCCTTGTGTCG AGG (reversed) Intergenic