ID: 1176550496

View in Genome Browser
Species Human (GRCh38)
Location 21:8218949-8218971
Sequence GCGCGCGCGCGTGCGTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176550491_1176550496 4 Left 1176550491 21:8218922-8218944 CCTCGACACAAGGGTTTGTCCGC No data
Right 1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG No data
1176550490_1176550496 5 Left 1176550490 21:8218921-8218943 CCCTCGACACAAGGGTTTGTCCG No data
Right 1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176550496 Original CRISPR GCGCGCGCGCGTGCGTGCGG GGG Intergenic