ID: 1176550697

View in Genome Browser
Species Human (GRCh38)
Location 21:8219559-8219581
Sequence CGGAGCGTCCCCGTCTCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176550691_1176550697 -2 Left 1176550691 21:8219538-8219560 CCCGTCGGGACGAACCGCAACCG No data
Right 1176550697 21:8219559-8219581 CGGAGCGTCCCCGTCTCGGTCGG No data
1176550685_1176550697 27 Left 1176550685 21:8219509-8219531 CCTTCTCCACCGAGCGGCGTGTA No data
Right 1176550697 21:8219559-8219581 CGGAGCGTCCCCGTCTCGGTCGG No data
1176550687_1176550697 21 Left 1176550687 21:8219515-8219537 CCACCGAGCGGCGTGTAGGAGTG No data
Right 1176550697 21:8219559-8219581 CGGAGCGTCCCCGTCTCGGTCGG No data
1176550688_1176550697 18 Left 1176550688 21:8219518-8219540 CCGAGCGGCGTGTAGGAGTGCCC No data
Right 1176550697 21:8219559-8219581 CGGAGCGTCCCCGTCTCGGTCGG No data
1176550692_1176550697 -3 Left 1176550692 21:8219539-8219561 CCGTCGGGACGAACCGCAACCGG No data
Right 1176550697 21:8219559-8219581 CGGAGCGTCCCCGTCTCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176550697 Original CRISPR CGGAGCGTCCCCGTCTCGGT CGG Intergenic
No off target data available for this crispr