ID: 1176552752

View in Genome Browser
Species Human (GRCh38)
Location 21:8236149-8236171
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176552752_1176552762 3 Left 1176552752 21:8236149-8236171 CCGGCTCCCCCCACTACCCACGT No data
Right 1176552762 21:8236175-8236197 TTCACCTTAATTTAGTGAGTCGG No data
1176552752_1176552766 12 Left 1176552752 21:8236149-8236171 CCGGCTCCCCCCACTACCCACGT No data
Right 1176552766 21:8236184-8236206 ATTTAGTGAGTCGGTTAGGTGGG No data
1176552752_1176552764 8 Left 1176552752 21:8236149-8236171 CCGGCTCCCCCCACTACCCACGT No data
Right 1176552764 21:8236180-8236202 CTTAATTTAGTGAGTCGGTTAGG No data
1176552752_1176552765 11 Left 1176552752 21:8236149-8236171 CCGGCTCCCCCCACTACCCACGT No data
Right 1176552765 21:8236183-8236205 AATTTAGTGAGTCGGTTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176552752 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr