ID: 1176553042

View in Genome Browser
Species Human (GRCh38)
Location 21:8238388-8238410
Sequence GATACCTCTGCATTGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176553040_1176553042 -10 Left 1176553040 21:8238375-8238397 CCGAGGTCAAATGGATACCTCTG No data
Right 1176553042 21:8238388-8238410 GATACCTCTGCATTGGCCCGAGG No data
1176553039_1176553042 -7 Left 1176553039 21:8238372-8238394 CCACCGAGGTCAAATGGATACCT No data
Right 1176553042 21:8238388-8238410 GATACCTCTGCATTGGCCCGAGG No data
1176553034_1176553042 11 Left 1176553034 21:8238354-8238376 CCGCAAAGCTGACCTGTCCCACC No data
Right 1176553042 21:8238388-8238410 GATACCTCTGCATTGGCCCGAGG No data
1176553036_1176553042 -1 Left 1176553036 21:8238366-8238388 CCTGTCCCACCGAGGTCAAATGG No data
Right 1176553042 21:8238388-8238410 GATACCTCTGCATTGGCCCGAGG No data
1176553038_1176553042 -6 Left 1176553038 21:8238371-8238393 CCCACCGAGGTCAAATGGATACC No data
Right 1176553042 21:8238388-8238410 GATACCTCTGCATTGGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176553042 Original CRISPR GATACCTCTGCATTGGCCCG AGG Intergenic
No off target data available for this crispr